Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 587567
End position: 587590
Length: 24

DNA sequence
>NC_017279, from 587567 to 587590 (24 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTTGATTTTTATTTGGATTATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 586525-588714	Sequence	CJSA_0590 hypF [NiFe] hydrogenase maturation protein HypF