Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 800417
End position: 800446
Length: 30

DNA sequence
>NC_017279, from 800417 to 800446 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTTTTAAAGTATTTTCAAGTTTTTCAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 799181-801340	Sequence	CJSA_0804 - hypothetical protein (Protein is coded in complementary strand; from 801340 to 799181)