Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 819122
End position: 819146
Length: 25

DNA sequence
>NC_017279, from 819122 to 819146 (25 bp); Campylobacter jejuni subsp. jejuni IA3902 ATAAACTAAAAAAAATTAAAATACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 818524-819156	Sequence	CJSA_0826 - hypothetical protein (Protein is coded in complementary strand; from 819156 to 818524)