Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 878636
End position: 878659
Length: 24

DNA sequence
>NC_017279, from 878636 to 878659 (24 bp); Campylobacter jejuni subsp. jejuni IA3902 AACTTTAGCTTTAACTTCATCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 876945-880457	Sequence	CJSA_0883 aas 2-acylglycerophosphoethanolamine acyltransferase (Protein is coded in complementary strand; from 880457 to 876945)