Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 886268
End position: 886297
Length: 30

DNA sequence
>NC_017279, from 886268 to 886297 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 CATTTAAAAACATTTCTAAACCTTTATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 883693-886281	Sequence	CJSA_0887 secA preprotein translocase subunit SecA (Protein is coded in complementary strand; from 886281 to 883693)