Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 887350
End position: 887382
Length: 33

DNA sequence
>NC_017279, from 887350 to 887382 (33 bp); Campylobacter jejuni subsp. jejuni IA3902 AAAATTTTTCTAAAGTTTTTTTAAAATTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 886887-887621	Sequence	CJSA_0889 - hypothetical protein (Protein is coded in complementary strand; from 887621 to 886887)