Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 959044
End position: 959073
Length: 30

DNA sequence
>NC_017279, from 959044 to 959073 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 TTCTTTTTTTTCATTTTTTTTGCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 958136-959437	Sequence	CJSA_0967 flgR sigma-54 associated transcriptional activator (Protein is coded in complementary strand; from 959437 to 958136)