Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 978038
End position: 978061
Length: 24

DNA sequence
>NC_017279, from 978038 to 978061 (24 bp); Campylobacter jejuni subsp. jejuni IA3902 AATAATAACAATAATAACATTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 976926-978089	Sequence	CJSA_0983 - putative MFS (Major Facilitator Superfamily) transport protein (Protein is coded in complementary strand; from 978089 to 976926)