Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 999524
End position: 999547
Length: 24

DNA sequence
>NC_017279, from 999524 to 999547 (24 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTTTTTTTCTTTTTTTGCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 998257-999618	Sequence	CJSA_1002 gatA aspartyl/glutamyl-tRNA amidotransferase subunit A (Protein is coded in complementary strand; from 999618 to 998257)