Sequence retrieval

Genome: Chlamydophila pneumoniae LPCoLN
Start position: 1185054
End position: 1185077
Length: 24

DNA sequence
>NC_017285, from 1185054 to 1185077 (24 bp); Chlamydophila pneumoniae LPCoLN ATCTAAACCTAAATTTAAATCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1183168-1185192	Sequence	CPK_ORF00201 - extracellular repeat, HAF family/autotransporter beta-domain protein (Protein is coded in complementary strand; from 1185192 to 1183168)