Sequence retrieval

Genome: Chlamydophila pneumoniae LPCoLN
Start position: 179296
End position: 179322
Length: 27

DNA sequence
>NC_017285, from 179296 to 179322 (27 bp); Chlamydophila pneumoniae LPCoLN GGTCCTTCAGGTCCTTCGGCTCCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 176812-179784	Sequence	CPK_ORF01089 - hypothetical protein (Protein is coded in complementary strand; from 179784 to 176812)