Sequence retrieval

Genome: Chlamydophila pneumoniae LPCoLN
Start position: 328512
End position: 328535
Length: 24

DNA sequence
>NC_017285, from 328512 to 328535 (24 bp); Chlamydophila pneumoniae LPCoLN GGTGTAGGTGGAGGTGTAGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 326496-329420	Sequence	CPK_ORF00967 - putative outer membrane protein 5 (Protein is coded in complementary strand; from 329420 to 326496)