Sequence retrieval

Genome: Chlamydophila pneumoniae LPCoLN
Start position: 604375
End position: 604399
Length: 25

DNA sequence
>NC_017285, from 604375 to 604399 (25 bp); Chlamydophila pneumoniae LPCoLN CTTTTATTTTCTTTTTTTTTCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 604379-605323	Sequence	CPK_ORF00705 oppB oligopeptide ABC transporter, permease protein OppB (Protein is coded in complementary strand; from 605323 to 604379)