Sequence retrieval

Genome: Chlamydophila psittaci 01DC11
Start position: 1078894
End position: 1078917
Length: 24

DNA sequence
>NC_017289, from 1078894 to 1078917 (24 bp); Chlamydophila psittaci 01DC11 CTTTAGGTTTAGCTTTTGCTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1078153-1079382	Sequence	CPS0A_1009 brnQ branched-chain amino acid transport system II carrier protein