Sequence retrieval

Genome: Chlamydophila psittaci 01DC11
Start position: 222560
End position: 222589
Length: 30

DNA sequence
>NC_017289, from 222560 to 222589 (30 bp); Chlamydophila psittaci 01DC11 CAGGAGCAGGAGAAGGAGGAGGAGTAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 217450-222843	Sequence	CPS0A_0237 pmp1B polymorphic outer membrane protein B family protein (Protein is coded in complementary strand; from 222843 to 217450)