Sequence retrieval

Genome: Chlamydophila psittaci 01DC11
Start position: 467904
End position: 467927
Length: 24

DNA sequence
>NC_017289, from 467904 to 467927 (24 bp); Chlamydophila psittaci 01DC11 TGGTGGTGGTGCAGGTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 467311-468711	Sequence	CPS0A_0459 - hypothetical protein (Protein is coded in complementary strand; from 468711 to 467311)