Sequence retrieval

Genome: Chlamydophila psittaci 01DC11
Start position: 544039
End position: 544062
Length: 24

DNA sequence
>NC_017289, from 544039 to 544062 (24 bp); Chlamydophila psittaci 01DC11 TAAATCTATACATCTATAATTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 543090-544058	Sequence	CPS0A_0527 - hypothetical protein
ORF... 544061-545143	Sequence	CPS0A_0528 lpxD UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase (Protein is coded in complementary strand; from 545143 to 544061)