Sequence retrieval

Genome: Chlamydophila psittaci 01DC11
Start position: 635076
End position: 635099
Length: 24

DNA sequence
>NC_017289, from 635076 to 635099 (24 bp); Chlamydophila psittaci 01DC11 GTTCTTGTGCTTGTTCTTGTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 634520-635419	Sequence	CPS0A_0613 - adherence factor (Protein is coded in complementary strand; from 635419 to 634520)