Sequence retrieval

Genome: Chlamydophila psittaci 01DC11
Start position: 802246
End position: 802269
Length: 24

DNA sequence
>NC_017289, from 802246 to 802269 (24 bp); Chlamydophila psittaci 01DC11 CAGCAGCACCAGCACCAGCAGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 802002-802397	Sequence	CPS0A_0753 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 802397 to 802002)