Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 783306
End position: 783329
Length: 24

DNA sequence
>NC_017295, from 783306 to 783329 (24 bp); Clostridium acetobutylicum EA 2018 AATTAAAATTAGAACTAAAATTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 783062-783601	Sequence	CEA_G0688 pssA phosphatidylserine synthase (Protein is coded in complementary strand; from 783601 to 783062)