Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1334484
End position: 1334507
Length: 24

DNA sequence
>NC_017297, from 1334484 to 1334507 (24 bp); Clostridium botulinum F str. 230613 AAAGATAAAGCTAAATATAGAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1333265-1334953	Sequence	CBF_1247 - glycerophosphoryl diester phosphodiesterase family protein