Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1577877
End position: 1577900
Length: 24

DNA sequence
>NC_017297, from 1577877 to 1577900 (24 bp); Clostridium botulinum F str. 230613 TTTATTTTTATTTCTATTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1577866-1579140	Sequence	CBF_1479 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 1579140 to 1577866)