Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1722696
End position: 1722719
Length: 24

DNA sequence
>NC_017297, from 1722696 to 1722719 (24 bp); Clostridium botulinum F str. 230613 CAGCTACAGCTAAAGCTACAGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1720901-1723537	Sequence	CBF_1604 - cation-transporting ATPase, P-type (Protein is coded in complementary strand; from 1723537 to 1720901)