Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1823129
End position: 1823152
Length: 24

DNA sequence
>NC_017297, from 1823129 to 1823152 (24 bp); Clostridium botulinum F str. 230613 AATTTGATAATGTGATAATTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1822736-1824127	Sequence	CBF_1693 acoL TPP-dependent acetoin dehydrogenase complex, E3 component, dihydrolipoamide dehydrogenase