Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2036965
End position: 2036988
Length: 24

DNA sequence
>NC_017297, from 2036965 to 2036988 (24 bp); Clostridium botulinum F str. 230613 TTTCATTTTCATTCTCATTTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2036811-2037332	Sequence	CBF_1887 - hypothetical protein (Protein is coded in complementary strand; from 2037332 to 2036811)