Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2078673
End position: 2078696
Length: 24

DNA sequence
>NC_017297, from 2078673 to 2078696 (24 bp); Clostridium botulinum F str. 230613 ATCATCATCCTCATCTTCATCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2078494-2078913	Sequence	CBF_1943 - hypothetical protein (Protein is coded in complementary strand; from 2078913 to 2078494)