Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2223488
End position: 2223511
Length: 24

DNA sequence
>NC_017297, from 2223488 to 2223511 (24 bp); Clostridium botulinum F str. 230613 AATTTAAATTTTAATGTAAATTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2223356-2224708	Sequence	CBF_2079 - amino acid/peptide transporter (Protein is coded in complementary strand; from 2224708 to 2223356)