Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2651753
End position: 2651776
Length: 24

DNA sequence
>NC_017297, from 2651753 to 2651776 (24 bp); Clostridium botulinum F str. 230613 TATTAAAATTAATGTTAACATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2650626-2652644	Sequence	CBF_2516 - methyl-accepting chemotaxis protein (Protein is coded in complementary strand; from 2652644 to 2650626)