Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2892807
End position: 2892830
Length: 24

DNA sequence
>NC_017297, from 2892807 to 2892830 (24 bp); Clostridium botulinum F str. 230613 TTTTATATTTTTATTTTTTTCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2892739-2892864	Sequence	CBF_2757 - hypothetical protein (Protein is coded in complementary strand; from 2892864 to 2892739)