Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2952604
End position: 2952627
Length: 24

DNA sequence
>NC_017297, from 2952604 to 2952627 (24 bp); Clostridium botulinum F str. 230613 TTTGTTTTTATTTTTATTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2952481-2955351	Sequence	CBF_2813 - GyrA/ParC subunit family DNA topoisomerase (Protein is coded in complementary strand; from 2955351 to 2952481)