Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2958080
End position: 2958103
Length: 24

DNA sequence
>NC_017297, from 2958080 to 2958103 (24 bp); Clostridium botulinum F str. 230613 TATTATTAATATAATTATTAGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2957751-2958128	Sequence	CBF_2815 - hypothetical protein (Protein is coded in complementary strand; from 2958128 to 2957751)