Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3017343
End position: 3017366
Length: 24

DNA sequence
>NC_017297, from 3017343 to 3017366 (24 bp); Clostridium botulinum F str. 230613 TTTTCTTTTGCTTTTTCATATTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3017166-3017768	Sequence	CBF_2864 - hypothetical protein (Protein is coded in complementary strand; from 3017768 to 3017166)