Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3240153
End position: 3240176
Length: 24

DNA sequence
>NC_017297, from 3240153 to 3240176 (24 bp); Clostridium botulinum F str. 230613 AAAGCTAAAGCCAAAACTAATGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3239541-3240242	Sequence	CBF_3051 - hypothetical protein (Protein is coded in complementary strand; from 3240242 to 3239541)