Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3537181
End position: 3537204
Length: 24

DNA sequence
>NC_017297, from 3537181 to 3537204 (24 bp); Clostridium botulinum F str. 230613 CATTTTTATTTTCATTTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3537170-3537427	Sequence	CBF_3366 - hypothetical protein (Protein is coded in complementary strand; from 3537427 to 3537170)