Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3772109
End position: 3772132
Length: 24

DNA sequence
>NC_017297, from 3772109 to 3772132 (24 bp); Clostridium botulinum F str. 230613 TAACTTTAAATTTAACTTTAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3771769-3773049	Sequence	CBF_3597 - hypothetical protein (Protein is coded in complementary strand; from 3773049 to 3771769)