Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 380665
End position: 380688
Length: 24

DNA sequence
>NC_017297, from 380665 to 380688 (24 bp); Clostridium botulinum F str. 230613 TATTTTTATGTTTATTTATATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 380470-382332	Sequence	CBF_0360 - peptide ABC transporter, Pep4E family, permease protein