Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3876393
End position: 3876416
Length: 24

DNA sequence
>NC_017297, from 3876393 to 3876416 (24 bp); Clostridium botulinum F str. 230613 TAACTTTAACCTTTACTTTATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3876167-3876571	Sequence	CBF_3716 - putative general stress protein (Protein is coded in complementary strand; from 3876571 to 3876167)