Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3888630
End position: 3888653
Length: 24

DNA sequence
>NC_017297, from 3888630 to 3888653 (24 bp); Clostridium botulinum F str. 230613 TTCATTTTTATTTTCTTTTTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3887725-3888897	Sequence	CBF_3728 - putative protease (Protein is coded in complementary strand; from 3888897 to 3887725)