Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3972297
End position: 3972320
Length: 24

DNA sequence
>NC_017297, from 3972297 to 3972320 (24 bp); Clostridium botulinum F str. 230613 AATTTTAACTTTAAATTTAATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3972103-3972546	Sequence	CBF_3816 rplI 50S ribosomal protein L9 (Protein is coded in complementary strand; from 3972546 to 3972103)