Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3985544
End position: 3985567
Length: 24

DNA sequence
>NC_017297, from 3985544 to 3985567 (24 bp); Clostridium botulinum F str. 230613 GGTATTGTTATTGTTATTTGTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3985535-3986314	Sequence	CBF_3834 - parB family protein (Protein is coded in complementary strand; from 3986314 to 3985535)