Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 206697
End position: 206721
Length: 25

DNA sequence
>NC_017297, from 206697 to 206721 (25 bp); Clostridium botulinum F str. 230613 TTTTTGTTTTGTTTTTTTGTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 206669-208030	Sequence	CBF_0207 - peptidase family protein (Protein is coded in complementary strand; from 208030 to 206669)