Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2219461
End position: 2219485
Length: 25

DNA sequence
>NC_017297, from 2219461 to 2219485 (25 bp); Clostridium botulinum F str. 230613 ATTTTATATTATTTCTTTTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2218944-2219609	Sequence	CBF_2073 catB chloramphenicol acetyltransferase (Protein is coded in complementary strand; from 2219609 to 2218944)