Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2397904
End position: 2397928
Length: 25

DNA sequence
>NC_017297, from 2397904 to 2397928 (25 bp); Clostridium botulinum F str. 230613 CTCTTCTTTTCTCATTTCTTCTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2397893-2399107	Sequence	CBF_2228 - putative hydroxyacyl-CoA:R-2-hydroxyglutaryl-CoA transferase (Protein is coded in complementary strand; from 2399107 to 2397893)