Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2519815
End position: 2519839
Length: 25

DNA sequence
>NC_017297, from 2519815 to 2519839 (25 bp); Clostridium botulinum F str. 230613 TCATTTCATTTCTTTCCATTTGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2519292-2519834	Sequence	CBF_2365 - hypothetical protein (Protein is coded in complementary strand; from 2519834 to 2519292)