Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2905574
End position: 2905598
Length: 25

DNA sequence
>NC_017297, from 2905574 to 2905598 (25 bp); Clostridium botulinum F str. 230613 TTTTTTCTTTTTTTACTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2905138-2906937	Sequence	CBF_2772 - hypothetical protein (Protein is coded in complementary strand; from 2906937 to 2905138)