Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 3616863
End position: 3616887
Length: 25

DNA sequence
>NC_017297, from 3616863 to 3616887 (25 bp); Clostridium botulinum F str. 230613 TTTTCTTTTATTTTATCTTCGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3616824-3619751	Sequence	CBF_3463 - putative peptidase (Protein is coded in complementary strand; from 3619751 to 3616824)