Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1613588
End position: 1613614
Length: 27

DNA sequence
>NC_017297, from 1613588 to 1613614 (27 bp); Clostridium botulinum F str. 230613 CAGCTGAAACTGCTGAAACTGCTGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1611871-1613664	Sequence	CBF_1505 npr-3 thermolysin metallopeptidase (Protein is coded in complementary strand; from 1613664 to 1611871)