Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1885215
End position: 1885241
Length: 27

DNA sequence
>NC_017297, from 1885215 to 1885241 (27 bp); Clostridium botulinum F str. 230613 TTCTATATCCTCTATATCTTCTATAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1884853-1885272	Sequence	CBF_1748 - hypothetical protein (Protein is coded in complementary strand; from 1885272 to 1884853)