Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 1893243
End position: 1893269
Length: 27

DNA sequence
>NC_017297, from 1893243 to 1893269 (27 bp); Clostridium botulinum F str. 230613 TACTTCTATTACTTCTTTTACTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1892467-1893360	Sequence	CBF_1754 cheV chemotaxis protein CheV (Protein is coded in complementary strand; from 1893360 to 1892467)