Sequence retrieval

Genome: Clostridium botulinum F str. 230613
Start position: 2549475
End position: 2549501
Length: 27

DNA sequence
>NC_017297, from 2549475 to 2549501 (27 bp); Clostridium botulinum F str. 230613 TCATTCTCTTCATCCTCTTCATCCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2548457-2549479	Sequence	CBF_2410 - phage head morphogenesis protein (Protein is coded in complementary strand; from 2549479 to 2548457)
ORF. 2549469-2550920	Sequence	CBF_2411 - phage portal protein, SPP1 family (Protein is coded in complementary strand; from 2550920 to 2549469)